35S CaMV 35S promoter, GUS β-glucuronidase, mGFP5 modified green... | Download Scientific Diagram
Synthetic promoters: genetic control through cis engineering: Trends in Plant Science
IJMS | Free Full-Text | Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops
Addgene: pMpGWB106
11
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Team:IIT-Madras/Design - 2019.igem.org
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
High-efficiency protein expression in plants from agroinfection-compatible Tobacco mosaic virusexpression vectors | BMC Biotechnology | Full Text
Cauliflower mosaic virus - Wikipedia
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus
Detection of the CaMV-35S Promoter Sequence in Maize Pollen and Seed | Semantic Scholar
Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods | Scientific Reports
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
![PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar](https://d3i71xaburhd42.cloudfront.net/358e7629cb7529cf210706439d927c9de8871820/3-Figure1-1.png "PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar")
PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar
A) Sequence comparison of domain A (–90 to +1) of the 35S promoter... | Download Scientific Diagram
Transcriptional silencing of 35S driven-transgene is differentially determined depending on promoter methylation heterogeneity at specific cytosines in both plus- and minus-sense strands | BMC Plant Biology | Full Text
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
PDF) A Short History of the CaMV 35S Promoter | Marc Somssich - Academia.edu
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters | SpringerLink
Figure 1 - Expression of Bacillus thuringiensis insecticidal protein gene in transgenic oil palm
IJMS | Free Full-Text | A Novel Moderate Constitutive Promoter Derived from Poplar (Populus tomentosa Carrière)
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
